Oops! It appears that you have disabled your Javascript. In order for you to see this page as it is meant to appear, we ask that you please re-enable your Javascript!

Những bí ẩn của hệ gen người

Hệ gen, genome, kích cỡ hệ gen người, ADN satellite, telomere, centromere, ADN lặp lại, gen mã hóa, LINE, SINE, Alu, transposon, những bí ẩn của hệ gen người, intron, exon

Những bí ẩn của hệ gen người

Hệ gen (genome) của một cơ thể hay một virus gồm DNA (hay ở một số virus là RNA) chứa đựng một bản sao hoàn chỉnh tất cả các thông tin di truyền của một cơ thể hay virus đó. Với nhiều virus hay nhân sơ, hệ gen tồn tại thành một hay một số sợi đơn hoặc phân tử DNA vòng. Các tế bào nhân thực có một hệ gen nhân và một hệ gen ty thể, và trong trường hợp của thực vật và tảo còn có một hệ gen trong lục lạp. Hệ gen trong ty thể và lục lạp thường là phân tử DNA duy nhất, dạng vòng. Hệ gen nhân thường bao gồm các phân tử DNA kép phân tán bên trong một bộ các nhiễm sắc thể đơn bội. Những bí ẩn của hệ gen người  Những bí ẩn của hệ gen người

Kích thước hệ gen thường liên hệ với tính phức tạp của sinh vật

Kích thước hệ gen thường biểu hiện tổng số lượng cặp base nucleotides, hay bp. Ví dụ, phân tử DNA vòng tạo nên hệ gen của E.coli có 4.639.221 bp. Khi mà số lượng này có xu hướng tăng lên, viết tắt là Kb, Mb, Gb được dùng để ký hiệu một ngàn, hay một triệu, hay một tỉ cặp base. Vì thế kích cỡ hệ gen của E.coli được biểu diễn đơn giản là 4.6 Mb. Phạm vi của kích thước hệ gen của nhiều nhóm sinh vật được tóm tắt trong hình. Những bí ẩn của hệ gen người

Hệ gen, genome, kích cỡ hệ gen người, ADN satellite, telomere, centromere, ADN lặp lại, gen mã hóa, LINE, SINE, Alu, transposon, những bí ẩn của hệ gen người, intron, exon

Khoảng biến thiên của kích thước hệ gen ở các lớp sinh vật. Các loài thú ít có sự biến thiên về kích cỡ hệ gen, tương tự bò sát và chim… trái ngược với thực vật, lưỡng cư và động vật nguyên sinh

Nói chung kích cỡ hệ gen tăng cùng với tính phức tạp của cơ thể. Các viruses chứa đủ axit nucleic để mã hóa cho một vài hay vài chục protein, vi khuẩn có thể có một vài ngàn protein, và các tế bào nhân thực có đủ DNA (ít nhất là theo lý thuyết) để mã hóa cho hàng trăm ngàn protein. Nhưng xem xét kỹ hơn các dữ liệu đó cho thấy một số đặc điểm khó hiểu. Đáng chú ý nhất là kích thước hệ gen của các sinh vật nhân thực không phải lúc nào cũng liên hệ với tính phức tạp sinh vật. Một số thực vật và lưỡng cư có hệ gen khổng lồ, lớn hơn gấp hàng chục hoặc thậm chí hàng trăm lần hệ gen của các loài thực vật, lưỡng cư khác hay của các loài thú. Trillium là một ví dụ, là một thành viên của họ Lily, chúng không có nhu cầu rõ ràng để giải thích cho lượng thông tin di truyền khổng lồ. Kích cỡ hệ gen của nó lớn hơn thực vật khác 20 lần và con người 30 lần. Kỳ lạ hơn nữa, một sinh vật đơn bào như amip (amoeba) có hệ gen bằng 200 lần hệ gen của con người. Chúng ta không có ý tưởng gì để giải thích tại sao các loài Lily và trùng amip lại chứa nhiều DNA đến thế. Sự có mặt của nó nhấn mạnh thực tế là hầu hết hệ gen của các sinh vật nhân thực mang một lượng lớn DNA mà đến nay vẫn chưa rõ chức năng, một hiện tượng mà ta sẽ bàn luận phía dưới. Cuối cùng, kích thước hệ gen cũng không quan trọng bằng số lượng,  đặc tính của các gene cũng như các trình tự DNA điều khiển sự biểu hiện của nó. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người

Những khác biệt nhỏ trong trình tự hệ gen phân biệt người này với người khác

Trình tự được công bố về hệ gen người thực tế là một thể khảm thu được từ phân tích DNA phân lập từ nhiều người khác nhau. Trung bình khoảng 99.7% số cặp bases trong hệ gen của bạn sẽ trùng khớp hoàn toàn với trình tự trong công bố này, hoặc với hệ gen của người hàng xóm cạnh cửa sổ nhà bạn (:D). Nhưng còn lại 0.3% số cặp bases khsac biệt giữa người này với người khác tạo ra các đặc điểm làm cho chúng ta là những cá thể duy nhất. Các khác biệt  này có liên quan tới các thay đổi từng base riêng lẻ được gọi là nucleotide đa hình (single nucleotide polymorphisms, SNPs – đọc là “snips”). Mặc dù 0.3% nghe có vẻ không lớn lắm, 0.3% được nhân với 3.2 tỉ cặp bases trong hệ gen thu được tất cả khoảng gần 10 triệu SNPs. Các nhà khoa học tạo ra các cơ sở dữ liệu chứa phần lớn SNPs phổ biến nhất, được cho là quan trọng nhất bởi vì một số trong số các biến đổi di truyền nhỏ có thể ảnh hưởng tới nguy cơ bạn mắc một số bệnh hoặc xác định mức độ đáp ứng với một phương pháp điều trị nhất định. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người 

Tuy nhiên hầu hết các SNPs lại không nằm trên các vùng của gene mã hóa protein. Vậy làm thế nào chúng ta tìm ra SNPs nào có liên quan tới các đặc điểm quan trọng, ví dụ như tính mẫn cảm với một bệnh đặc trưng? May mắn thay, không cần thiết phải kiểm tra toàn bộ 10 triệu SNPs một cách riêng rẽ bởi các này SNPs không độc lập với các SNPs khác. Các SNPs định vị gần nhau trên cùng một nhiễm sắc thể có xu hướng được di truyền cùng nhau trong một khối được gọi là haplotypes. Một cơ sở dữ liệu về các haplotypes này được gọi là HapMap cung cấp một đường tắt cho các nhà khoa học quan tâm tới quan hệ giữa các gene và bệnh: chỉ có khoảng vài trăm ngàn SNPs (mỗi cái định vị trên một haplotype khác nhau) cần được kiểm tra chứ không phải 10 triệu. Khi có một dấu hiệu liên kết với một haplotype đặc biệt, chỉ các SNPs trong haplotype đó được nghiên cứu tiếp để xác định cái nào chịu trách nhiệm về biểu hiện đó. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người

Các SNPs không chỉ là nguồn gốc của các biến dị di truyền mà còn xác định tính riêng biệt của một người. Sự đảo, mất, lặp DNA cũng đóng góp vào tính biến đổi giữa các hệ gen. Các cơ chế này đã tạo ra các mảnh DNA dài hàng ngàn nucleotides với số lượng bản sao khác nhau giữa những cá nhân khác nhau. Hệ gen của mỗi người được cho là chứa hàng trăm biến dị số bản sao (copy number variations – CNVs) liên quan tới hàng triệu cặp bases của toàn DNA. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người 

Lượng kiến thức về hệ gen người đang tăng nhanh chóng, được minh chứng bằng việc các phát hiện về cơ sở di truyền của nhiều bệnh – từ ung thư vú, ung thư dạ dày đến tiểu đường hay Alzheimer – đang được báo cáo với tốc độ ngày càng tăng. Các phát hiện này hứa hẹn cuộc cách mạng hóa với tương lai nghề y vì người ta có khả năng xác định các gene bệnh và nghiên cứu chức năng của chúng để phát triển các phương pháp điều trị để làm giảm nhẹ hay thậm chí ngăn chặn bệnh. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người

Tuy nhiên có thể xác định các gene có khả năng gây hại lại phát sinh thêm vấn đề liên quan tới đạo đức bởi vì tất cả chúng ta có thể mang hàng chục gene liên quan đến nguy cơ nào đó. Ví dụ thông tin này có thể bị lạm dụng nhằm phân biệt di truyền đối với các cá nhân hay các nhóm người bởi các công ty bảo hiểm, các ông chủ hay thậm chí là các cơ quan chính phủ. Hơn thế nữa, hiểu biết chi tiết về hệ gen người làm tăng tiềm năng cho sử dụng công nghệ DNA tái tổ hợp để thay đổi các genes của người không chỉ nhằm chữa các bệnh mà còn thay đổi các genes trong tinh trùng và trứng, vì thế thay đổi bản chất di truyền của các thế hệ tương lai. Đây là câu hỏi rõ ràng liên quan không chỉ tới các nhà khoa học mà còn toàn xã hội loài người. Những bí ẩn của hệ gen người

Các trình tự DNA lặp lại giải thích một phần cho kích thước của các hệ gen sinh vật nhân thực

Bên cạnh những khó khăn mà nó gây ra cho việc nghiên cứu trình tự DNA, kích thước khổng lồ của hệ gen người nảy sinh một câu hỏi cơ bản hơn: Có phải lượng lớn DNA trong các tế bào người phản ánh một cách đơn thuần rằng số genes phải nhiều gấp hàng ngàn lần so với số genes có trong tế bào vi khuẩn, hay các nhân tố khác cũng vậy? Đột phá đầu tiên trong việc trả lời câu hỏi này xuất hiện vào cuối những năm 1960, khi các nghiên cứu sự hồi tính DNA được thực hiện bởi Roy Britten và David Kohne dẫn tới phát kiến về các trình tự DNA lặp.

Trong các tế bào vi khuẩn hầu như tất cả DNA đều không lặp lại – nonrepeated, trong các tế tế bào nhân thực thể hiện một sự biến thiên rất lớn lớn về lượng DNA lặp lại so với DNA không lặp lại. Điều này giúp lý giải bí ẩn về hàm lượng DNA có vẻ như dư thừa trong một số  loài như là Trillium : sinh vật này chứa một lượng tương đối lớn DNA lặp lại. Sử dụng kỹ thuật giải trình tự, các nhà nghiên cứu có khả năng xác định trình tự các bases của nhiều loại DNAs lặp và có thể phân loại chính thành hai nhóm chính : DNA lặp liên tục (tandemly repeated DNA) và DNA lặp rời rạc (interspersed repeated DNA). Những bí ẩn của hệ gen người

Hệ gen, genome, kích cỡ hệ gen người, ADN satellite, telomere, centromere, ADN lặp lại, gen mã hóa, LINE, SINE, Alu, transposon, những bí ẩn của hệ gen người, intron, exon

Hình 2. Các loại ADN trong hệ gen người và hàm lượng tương ứng. Khoảng 45% hệ gen người là các yếu tố lặp lại. Khoảng 1/4 hệ gen là gen, nhưng chỉ 1.5% trình tự ADN là thực sự tạo ra sản phẩm.

Tandemly repeated DNA bởi vì nhiều bản sao của cùng một trình tự được xếp cạnh nhau thành một chuỗi. Các DNA lặp liên tục chiếm 10 – 15% hệ gen của một loài thú điển hình và chứa nhiều loại trình tự DNA khác nhau thay đổi cả về chiều dài đoạn được lặp cũng như số lần lặp. Độ dài của đơn vị lặp có thể nằm đâu đó trong khoảng 1 – 2000 cặp base hoặc hơn. Tuy nhiên hầu hết các đơn vị lặp ngắn hơn 10 bp; do đó nhóm này được gọi là DNA lặp với trình tự lặp đơn giản SSR (simple-sequence repeated DNA ). Đây làm một ví dụ về một simple-sequence repeated DNA được tạo ra từ đơn vị lặp là 5 bases GTTAC : Những bí ẩn của hệ gen người 

… GTTACGTTACGTTACGTTAC ….

Số lần lặp lại liên tiếp của đơn vị GTTAC có thể lên tới một vài  trăm ngàn tại các vị trí đặc trưng trong hệ gen.

SSR được gọi nguyên gốc là satellite DNA (DNA vệ tinh) bởi vì thành phần base riêng biệt của nó thường khiến cho nó xuất hiện thành một băng tách biệt với phần còn lại của DNA hệ gen nếu ta ly tâm. Sự khác biệt về tỷ trọng này xuất hiện bởi adenine và guanine khác nhau một chút về khối lượng phân tử, cũng như cysteine với thymine ; vì thế, tỷ trọng của các DNAs với thành phần bases khác nhau cũng khác nhau. Những bí ẩn của hệ gen người

Chức năng của các SSR DNA (satellite DNA) là gì? Bởi các trình tự này không được phiên mã một cách thường xuyên, người ta cho rằng chúng có thể chịu trách nhiệm cho việc tạo ra các đặc trưng vật lý ở các vùng nhất định của nhiễm sắc thể. Trong phần lớn nhân thực, vùng nhiễm sắc thể được gọi là tâm động (centromeres) – có vai trò quan trọng trong việc phân chia nhiễm sắc thể trong quá trình phân bào – rất giàu các SSR đặc trưng, và các trình tự này có thể bộc lộ các đặc điểm cấu trúc đặc trưng ở centromere. Telomeres, là các trình tự DNA ở đầu mút các nhiễm sắc thể cũng có các SSR. Telomeres ở người chứa từ 250-1500 lần lặp trình tự TTAGGG, và trình tự này vẫn được bảo tồn tốt qua hàng trăm triệu năm tiến hóa. Tất cả các sinh vật có xương sống được nghiên cứu có trình tự tương đồng, và thậm chí cả các đơn bào nhân thực sở hữu các trình tự tương tự. Nhìn chung, các trình tự này là quan trọng đối với sự tồn tại của cá cơ thể này. Những bí ẩn của hệ gen người

Lượng satellite DNA được biểu hiện trong bất kỳ vị trí cho trước nào có thể thay đổi rất lớn. Các satellite DNAs điển hình thường có độ dài tổng là khoảng 105 đến 107 cặp base. Thuật ngữ minisatellite DNAs chỉ các vùng ngắn hơn, tổng độ dài từ 102 đến 105 cặp base, được hình thành từ một đơn vị lặp dài 10 -100 cặp base. Microsatellite DNAs với các đơn vị lặp chỉ 1-10 cặp base, và chỉ dài tổng cộng 10-100 cặp base. Các trình tự lặp ngắn tìm thấy trong các microsatellite và minisatellite DNA vô cùng hữu ích đối với dấu vân tay phân tử (DNA fingerprinting). Kỹ thuật này sử dụng điện di gel để đối chiếu các mảnh DNA có nguồn gốc từ các vùng trên hệ gen của hai hay nhiều cá nhân. Nó có ý nghĩa trong việc xác định một người cũng chính xác như phương pháp vân tay truyền thống. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen ngườiNhững bí ẩn của hệ gen người 

Các nhà nghiên cứu y học có một khám phá bất ngờ rằng hơn chục bệnh di truyền của hệ thống thần kinh có liên quan tới những thay đổi nhỏ trong các microsatellite DNAs. Đặc biệt hơn, các bệnh này hướng theo số lượng lớn các trình tự trinucleotides lặp lại trong một gene không bình thường. Ví dụ cho hiện tượng này là khuếch đại các đơn vị lặp 3 (triplet repeat amplification) được tìm thấy trong bệnh Huntington, một bệnh phá hủy hệ thần kinh tấn công từ giai đoạn tuổi trung niên và luôn gây chết. Bệnh Huntington thông thường chứa bộ ba nucleotide CAG lặp liên tục 11-34 lần. Tuy nhiên ở các trường hợp nguy hiểm có tới 100 bản lặp lại liên tục. Các bệnh thần kinh gây ra do sự khuếch đại của các trình tự lặp bộ ba khác bao gồm hội chứng nhiễm sắc thể X dễ gãy (fragile X), nguyên nhân chính của trí tuệ chậm chạp, và loạn trương lực cơ (myotonic dystrophy) ảnh hưởng tới cơ. Trong một số trường hợp bệnh, trình tự lặp nằm trong vùng không được dịch mã; số khác được dịch thành các mảnh polypeptide chứa một chuỗi dài các aminoaxit giống nhau. Trong cả hai trường hợp, mức độ nguy hiểm bệnh tỉ hệ với số bộ ba lặp lại. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người

Interspersed repeated DNA

Các đơn vị lặp của loại DNA này phân tán khắp hệ gen. Một đơn vị lặp đơn có xu hướng dài hàng trăm hay hàng ngàn cặp base, và các bản sao phân tán của nó, có thể lên tới hàng trăm hay hàng ngàn, tương đồng nhưng thường không hoàn toàn giống nhau. Loại DNA này thường chiếm 25-50% hệ gen của các loài thú.

Hầu hết DNA lặp phân tán thường chứa các họ gene nhảy (transposable elements / transposons) bởi chúng có thể di chuyển trong hệ gen và để lại các bản sao của chúng bất cứ nơi  nào nó dừng lại. Đáng chú ý là ở người, gần một nửa hệ gen chứa các nhân tố di động này. Phong phú  nhất, được gọi là LINEs (long interspersed nuclear elements) dài từ 6000-8000 cặp  base và chiếm gần 20% hệ gen. LINEs chứa các gene mã hóa ra các enzymes cần cho sự sao chép các trình tự LINE (và các nhân tố di động khác) và chèn các bản sao vào các nơi khác trên hệ gen. Một nhóm khác của các yếu tố di động, được gọi là SINEs (short interspersed nuclear elements) chứa các trình tự lặp có độ dài dưới 500 cặp base không chứa các gene, dựa vào enzyme mã hóa từ các nhân tố di động khác để di chuyển. Phần lớn SINEs ở người dài 300 cặp base và được gọi là các trình tự Alu sequences . Gần một triệu bản sao của trình tự Alu rải rác khắp hệ gen người, chiếm khoảng 10% DNA. DNA mã hóa các protein và phiên mã ra các RNA vận chuyển/ribosome ( DNA này được tìm thấy trong các exons) chiếm một lượng DNA thấp kinh ngạc trong tổng hệ gen người. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người 

Tính di động của LINEs, SINEs hay các nhân tố đổi chỗ khác được cho là tạo ra tính biến đổi trong hệ gen dẫn tới khả năng thích nghi tiến hóa của các sinh vật. Thêm nữa, sự di chuyển của một số LINEs có thể xuất hiện suốt quá trình phát triển bình thường và thay đổi sự biểu hiện của các gene liền kề, gợi ý một vai trò trong điều hòa gene. Nguồn gốc của các yếu tố đổi chỗ và các cơ chế mà nhờ đó chúng có thể di chuyển được sẽ được đề cập một cách đầy đủ ở một bài viết khác. Những bí ẩn của hệ gen người Những bí ẩn của hệ gen người 

Tham khảo:Becker’s  World of the Cell 8th edition

Đọc thêm: Phát hiện dạng cấu trúc DNA hoàn toàn mới trong tế bào người

Cơ quan mới phát hiện trong cơ thể người và con đường di căn ung thư

iceberg (biên dịch)

tapchisinhhoc.com

 

Những bí ẩn của hệ gen người
5 (100%) 15 votes

Leave a Reply