Oops! It appears that you have disabled your Javascript. In order for you to see this page as it is meant to appear, we ask that you please re-enable your Javascript!

Lược sử tiến hóa hệ gen người

Lược sử tiến hóa hệ gen người, lược sử, tiến hóa, hệ gen, genome, LUCA,

Lược sử tiến hóa hệ gen người

Từ những tế bào đầu tiên cho đến bình minh của giống loài chúng ta, hãy tham quan một vòng qua 3 tỷ năm tiến hóa. […] Trong khi chúng ta chỉ mới bắt đầu giải mã hồ sơ đó, chúng ta mới phát hiện ra rằng tổ tiên của chúng ta không chỉ đối diện với một cuộc tranh đấu khắc nghiệt để tồn tại trong một thế giới nhuốm màu đỏ với răng và vuốt. Đã có những trận chiến sử thi diễn ra trong genome của chúng ta, những trận chiến mà biến đổi cách thức hoạt động của genome và rốt cuộc tạo ra chúng ta của ngày nay… Lược sử tiến hóa hệ gen người

 GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG

Nó nhìn có vẻ thật khó hiểu, nhưng trình tự DNA này thực sự đáng chu ý. Nó có mặt trong tất cả các tế bào trong cơ thể bạn, trong mèo hoặc chó, trong con cá trên đĩa thức ăn, những con ong hay những con bướm trong vườn và trong những vi khuẩn đường ruột. Thực tế, ở bất cứ nơi nào bạn tìm thấy sự sống trên Trái đất, từ những núi lửa sôi sục sâu dưới đại dương cho tới những vi khuẩn đông cứng trong những đám mây trên hành tinh này, bạn đều tìm được trình tự đó. Bạn thậm chí còn có thể tìm thấy nó trong một số “thứ” không sống thực thụ, như là các virus khổng lồ, mimiviruses. Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người


            Trình tự này phổ biến đến vậy bởi vì nó đã tiến hóa trong một tổ tiên chung của mọi sự sống, và khi nó thực hiện một quá trình quan trọng, nó đã thay đổi từ đó. Nói một cách khác, một chút DNA của bạn có độ tuổi không thể tưởng tượng được là 3 tỉ năm, truyền lại cho bạn trong một chuỗi nguyên vẹn thông qua hàng tỉ tổ tiên.

            Các phần khác trong DNA của bạn là mới. Bạn có khoảng 100 đột biến trong genome mà không có mặt trong bố hay mẹ, là những thay đổi 1 hoặc 2 ký tự để mất đi hoặc có được những đoạn DNA lớn.

            Chúng ta có thể nói những phần DNA của ta là cũ hoặc mới bằng cách so sánh genome. So sánh genome của bạn với anh hoặc chị chẳng hạn, có thể chỉ ra các đột biến mới. Đối chiếu genome người với động vật chỉ ra nhiều thay đổi hơn. Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người

            Genome của chúng ta lại không chỉ là công thức để tạo nên con người. Chúng là những ghi chép lịch sử sinh động. Và bởi vì genome của chúng ta quá lớn, tạo nên từ hơn 6 tỷ ký tự DNA – đủ để tạo nên một chồng sách cao 10 mét – chúng ghi lại quá khứ của chúng ta chi tiết một cách phi thường. Chúng cho phép chúng ta lần theo dấu vết tiến hóa của ta từ thuở sơ khai của sự sống cho tới ngay hiện tại này. Lược sử tiến hóa hệ gen người

            Trong khi chúng ta chỉ mới bắt đầu giải mã hồ sơ đó, chúng ta mới phát hiện ra rằng tổ tiên của chúng ta không chỉ đối diện với một cuộc tranh đấu khắc nghiệt để tồn tại trong một thế giới nhuốm màu đỏ với răng và vuốt. Đã có những trận chiến sử thi diễn ra trong genome của chúng ta, những trận chiến mà biến đổi cách thức hoạt động của genome và rốt cuộc tạo ra chúng ta của ngày nay. Lược sử tiến hóa hệ gen người

Tổ tiên chung Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người

            Vào lúc ban đầu đã có RNA. Phân tử nhiều tài năng này có thể lưu giữ thông tin và xúc tác các phản ứng, có nghĩa là một số RNAs có thể tự sao chép. Miễn là có một phân tử RNA, hoặc một bộ các phân tử, bắt đầu tự sao chép, genome đầu tiên được hình thành. Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người

            Nhược điểm của RNA là nó không ổn định, vì thế từ rất sớm sự sống đã chuyển việc lưu trữ thông tin sang một phân tử khác với một chút khác biệt về bộ khung hóa học ít có khả năng bị phá vỡ hơn – DNA. Các protein cũng đã thay thế RNA trong vai trò xúc tác, với RNA được điều hòa để thực hiện chức năng của một chất trung gian. DNA lưu giữ công thức để tạo nên proteins, gửi đi các bản sao RNA của công thức tới bộ máy sản xuất protein.

            Nhiều dấu vết của một thế giới thống trị bởi RNA vẫn tồn tại trong genome của chúng ta. Trình tự phổ biến ở đầu bài báo này là ví dụ, mã hóa cho một phần của một RNA enzyme (ribozyme) vẫn thực hiện chức năng mấu chốt trong tổng hợp protein. Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người

            Khoảng 3.5 tỷ năm trước, một thực thể sống đã tiến hóa với một genome chứa các công thức để tạo ra RNAs và proteins – tổ tiên chung gần nhất của mọi sự sống (LUCA). Eugene Koonin tại Viện Y tế Quốc gia Bethesda, Maryland, người nghiên cứu về sự tiến hóa của cuộc sống, cho biết ít nhất 100 gen có thể tự tin được phát hiện trong LUCA, và LUCA có thể có tổng cộng hơn 1.000 gen. Lược sử tiến hóa hệ gen người 

            LUCA có rất nhiều bộ máy cốt lõi vẫn được tìm thấy trong tất cả các sự sống ngày nay, bao gồm bộ máy tổng hợp protein. Dù sao thì nó vẫn khá là không giống như sự sống mà chúng ta biết ngày nay. Một số nhà nghiên cứu cho rằng LUCA không phải một tế bào riêng rẽ có màng bao bọc mà là một hỗn hợp các yếu tố sao chép giống như virus nằm bên trong một số thành phần không sống.Lược sử tiến hóa hệ gen người

Sự phân ly và tái hợp nhất Lược sử tiến hóa hệ gen người

            Một kịch bản khả thi cho giai đoạn tiếp theo là một phân nhóm các yếu tố giống virus của LUCA vỡ ra ở 2 dịp khác nhau, có được màng tế bào bào và trở thành các tế bào đơn. Điều này có thể giải thích vì sao có 2 loại tế bào đơn – vi khuẩn và vi khuẩn cổ – mỗi loại với một màng tế bào khác biệt hoàn toàn. “Nó là một học thuyết thật quyến rũ”, Koonin nói. Điều chắc chắn là sự sống phân ly thành hai nhánh chính từ rất sớm.

            Vi khuẩn và vi khuẩn cổ đã tiến hóa một số cỗ máy phân tử tuyệt diệu và đã biến đổi hành tinh này, nhưng chúng vẫn duy trì ít hơn một cái túi hóa chất nhỏ. Nó vẫn chưa phải là một sự kiện hợp nhất 2 nhánh lớn của sự sống để các tế bào phức tạp, hay tế bào nhân thực, phát sinh – một sự kiện biến đổi genome và mở đường cho sự tiến hóa của động vật đầu tiên. Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người 

            Khoảng 1 tỷ năm trước, một vi khuẩn đã nhập vào bên trong một vi khuẩn cổ. Thay vì việc một con này giết con còn lại, hai con bắt đầu một mối quan hệ cộng sinh, trong đó các hậu duệ của vi khuẩn dần tiến hóa để thực hiện một chức năng quan trọng: chúng trở thành ty thể, nhà máy năng lượng của tế bào. Nếu không có sự hợp nhất này, sự sống phức tạp có lẽ sẽ không bao giờ tiến hóa được. Chúng ta có xu hướng giả định rằng đó là tự nhiên cho các sinh vật đơn giản tiến hóa thành các sinh vật phức tạp hơn, nhưng mỗi vi khuẩn và vi khuẩn cổ riêng rẽ không bao giờ tiến hóa tới một mức độ phức tạp. Sao vậy? Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người

            Theo Nick Lane tại đại học London, bởi vì chúng đã đạt được một mức năng lượng. Tất cả các sinh vật đơn bào sản sinh năng lượng sử dụng màng tế bào của chúng. Khi chúng trở nên lớn hơn, tỉ lệ diện tích bề mặt so với thể tích không còn hiệu quả, làm nó khó khăn hơn trong việc tạo ra năng lượng. Kết quả là các tế bào đơn lẻ phải giữ nguyên kích thước nhỏ – và các tế bào nhỏ không đủ không gian cho genome lớn. Ty thể loại bỏ được rào cản này bằng cách cung cấp nguồn năng lượng tự tạo, tách biệt. Các tế bào giờ có thể trở nên lớn hơn một cách đơn giản bằng cách tạo ra nhiều ty thể hơn, cho phép chúng mở rộng genome và vì thế tăng khả năng lưu trữ thông tin.

            Bên cạnh việc giải phóng tế bào khỏi sự hạn chế về năng lượng này, tổ tiên của ty thể cũng là ba phần tư nguồn gen của chúng ta. Vi khuẩn ban đầu có lẽ có khoảng 3.000 gen, và qua thời gian hầu hết chúng mất đi hoặc được chuyển cho genome chính, để lại ty thể hiện đại với chỉ một lượng nhỏ gen.

            Ngoài những lợi ích rõ ràng, sự kết hợp này cũng đầy rủi ro. Đặc biệt, genome của ty thể cổ xưa bị nhiễm các mảnh DNA ký sinh, hay transposon, chúng không làm gì khác ngoài việc tự tạo ra các bản sao của nó. Chúng đôi khi chui vào giữa gen, để lại đó những đoạn DNA không liên quan nay được biết như là intron. Nó như là việc dán một công thức cho món súp vào giữa công thức làm bánh ! Lược sử tiến hóa hệ gen người

            Dù sao thì các kết quả không phải luôn luôn là một công thức thảm họa, bởi vì các introns này tự cắt nối được: sau khi một bản RNA của một gen được tạo ra – bước đầu tiên của việc sản xuất protein – chúng tự cắt mình đi khỏi RNA. Điều này không phải luôn xảy ra, vì thế sự có mặt của nó (intron) là một điều bất lợi. Hầu hết vi khuẩn không có intron trong gen, bởi vì trong quần thể lớn có rất nhiều cạnh tranh giữa các cá thể, chọn lọc tự nhiên là rất mạnh và lấn át chúng. Nhưng quần thể của nhân thực cổ xưa rất nhỏ, nên chọn lọc là yếu. Các thể ký sinh di truyền đến cùng với các ty thể cổ xưa bắt đầu sao chép điên cuồng, chuyển vào genome chính hàng trăm intron. Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người

            Ngày nay, mỗi gene của chúng ta thường chứa khoảng 8 introns, nhiều trong số chúng có nguồn gốc từ sinh vật nhân chuẩn đầu tiên – những tổ tiên của chúng ta không bao giờ xoay xở để giải thoát khỏi chúng. Thay vào đó, những nhân chuẩn sớm đã tiến hóa theo những con đường phù hợp với chúng làm thay đổi cấu trúc gen của chúng ta và cách mà các tế bào sinh sôi. Một trong đó là giới tính. Lược sử tiến hóa hệ gen người

Lợi ích của giao phối Lược sử tiến hóa hệ gen người

            Điều quan trọng về giao phối không chỉ là sự pha trộn các gene từ các cá thể khác nhau, quan trọng vì đây là sự kết hợp những ưu thế về tiến hóa được tạo ra trong các dòng khác nhau. Các sinh vật đơn bào vốn đã trao đổi gen từ rất lâu mà không cần đến khác biệt giới tính. Lược sử tiến hóa hệ gen người v

            Đó cũng được gọi là quá trình tái tổ hợp, trong đó những cặp nhiễm sắc thể trao đổi các phần tương ứng khi được phân chia thành trứng hoặc tinh trùng. Tái tổ hợp giúp giải quyết một vấn đề căn bản với việc có một genome chứa nhiều gen nối với nhau như là một chuỗi hạt. Hình dung một chuỗi hạt với một hạt ngọc tuyệt vời nằm cạnh một hạt ngọc khiếm khuyết. Nếu một đột biến có lợi xuất hiện cạnh một đột biến có hại thì hoặc là đột biến có lợi sẽ mất hoặc đột biến có hại sẽ lan ra khắp quần thể. Tái tổ hợp cho bạn cơ hội để trao đổi các hạt ngọc. Cũng giống như khi bạn có thể tạo ra một chuỗi hạt hoàn hảo và một chuỗi khiếm khuyết, vì thế một số con cái sẽ có được một số lượng không cân xứng các gene tốt, trong khi một số con cái khác mất đi một gen xấu, có thể là phá vỡ introns. Những cá thể không may mắn có khả năng sẽ chết trong khi những cá thể khác có các gen tốt sẽ phát triển thịnh vượng.Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người Lược sử tiến hóa hệ gen người

            Trong những quần thể lớn, nhiều đột biến phát sinh mà một trong số đó sẽ chống lại tác động của các gene gây hại, vì vậy không cần đến sự tái tổ hợp. Nhưng trong những quần thể nhỏ thì giao phối sẽ thắng thế. Đây là lý do vì sao nó trở thành tiêu chuẩn cho các sinh vật nhân chuẩn sớm nhất và cho hầu hết thế hệ con cháu.

            Qua thời gian sự giao phối tiến hóa, có quá nhiều intron cần phải loại bỏ đi. Vì thế các nhân thực ban đầu sớm phải đối mặt với một vấn đề nghiêm trọng khác: khi intron có được ngày càng nhiều đột biến, cơ chế tự cắt nối trở nên thất bại. Để thích nghi, các nhân thực sớm này đã tiến hóa những bộ máy đặc biệt, được gọi là spliceosomes, có thể cắt các intron khỏi bản sao RNA. Lược sử tiến hóa hệ gen người 

            Spliceosome là một loại giải pháp tự động điển hình của tiến hóa: cắt đi những phần RNA không cần thiết, chứ không cắt đi DNA gốc, là rất kém hiệu quả. Hơn nữa, spliceosome lại chậm. Nhiều RNA đã tiếp cận được nhà máy sản xuất protein trước khi các intron của nó được cắt đi, dẫn tới protein khuyết tật. Đây là lý do nhân được tiến hóa, ông Koonin đề xuất. Khi DNA của một tế bào được bao bọc trong một thành phần tách biệt bới bộ máy sản xuất protein, chỉ các RNA đã cắt nối mới được phép ra ngoài, ngăn cản tế bào lãng phí năng lượng để tạo ra các protein vô tác dụng.

Lược sử tiến hóa hệ gen người, lược sử, tiến hóa, hệ gen, genome, LUCA,

Thậm chí cách đó còn chưa giải quyết được toàn bộ vấn đề. Spliceosomes thường cắt đi các phần mã hóa của gen – tức exons – do các lỗi, làm tạo ra các protein đột biến. “Cắt nối luân phiên không phải là một sự thích ứng”, ông Koonin cho biết. “Nó là một cái gì đó mà các sinh vật cần phải chấp nhận.”

            Vì thế các tổ tiên cổ xưa của ta đã tiến hóa từng lớp từng lớp cho bộ máy phức tạp để đối phó với sự gia tăng các intron, nhưng vẫn không thể giải quyết được hết các vấn đề mà chúng gây ra. Nhưng không giống như đơn bào, chúng (nhân thực) có thể chấp nhận được sự lãng phí đó vì chúng giải quyết được vấn đề năng lượng – và về lâu dài thì tất cả tính phức tạp bổ sung đó dẫn tới những cơ hội mới.

Tính linh hoạt và kiểm soát Lược sử tiến hóa hệ gen người

            Sự có mặt của intron và vì thế là cả exon, tạo ra đơn vị gen. Trong một gen không phân mảnh, các đột biến thêm hoặc mất đi các phần thường thay đổi cách mà phần còn lại sẽ được đọc, tạo ra lỗi. Các exon thì ngược lại, có thể được di chuyển xung quanh mà không làm phá vỡ phần còn lại của gen. Các gen giờ đây tiến hóa các exon bằng cách xáo trộn các exon bên trong gen hay giữa các gen. Lược sử tiến hóa hệ gen người

            Ví dụ, đề xuất rằng các đột biến ngẫu nhiên thêm một exon nữa vào một gen. Nhờ vào cắt nối luân phiên, phiên bản protein đầu tiên vẫn được tạo ra, nhưng nó cũng có nghĩa là một protein mới có thể đến từ cùng gen đó. Đột biến có thể có tác động nhỏ và vì thế không bị loại đi nhờ chọn lọc, nhưng theo thời gian, protein mới có thể bắt đầu thực hiện một chức năng mới. Đôi khi do ngẫu nhiên, sự nỗ lực vô thức của nhân thực trong việc “cư xử” với intron đã tạo ra các gen linh động hơn và có khả năng tiến hóa hơn. Lược sử tiến hóa hệ gen người

            Nếu cái nhìn này về sự tiến hóa của các tế bào phức tạp là đúng, nhiều đặc điểm mấu chốt của genome chúng ta, từ các đơn vị gen cho tới giao phối, đã tiến hóa như một hệ quả trực tiếp của việc có được các ty thể mang yếu tố ký sinh (intron). Những ý tưởng khác không thể bị phủ nhận, song không có ý kiến nào cung cấp một sự lý giải tuyệt vời đến vậy. “Đó là kịch bản ưa thích của tôi”, theo Koonin.

Tất cả các đặc điểm mới này dẫn tới một thời kỳ bùng nổ cho sự đổi mới tiến hóa, và nhân thực đã thịnh phát và trở nên đa dạng. Dẫu vậy, chúng vẫn phải đối mặt với một sự tấn công dữ dội từ cuộc xâm lăng của những loại virus và DNA ký sinh mới. Tuy nhiên, để vượt qua được những hạn chế về kích thước ở đơn bào, các tế bào phức tạp đã tự do tiến hóa những cơ chế phòng thủ phức tạp hơn. Lược sử tiến hóa hệ gen người

            Một cách là làm “câm” các gen ký sinh của transposon bằng cách thêm các nhãn (tag) vào DNA làm ngừng sao chép RNA – một quá trình gọi là methyl hóa. Một cách khác là phá hủy RNA của virus xâm nhiễm để ngừng sự nhân lên của chính nó. Các cơ chế phòng vệ này chỉ thành công một phần. Ngày nay, khoảng 5% genome người chứa phần còn lại của virus đã đột biến và gần như là trơ, rồi 50% là các tồn lưu của transposon, một minh chứng cho nhiều sự kiện mà từ khi ấy các thể ăn bám này bằng cách nào đó xâm nhập vào và lan tràn khắp genome của tổ tiên chúng ta. Lược sử tiến hóa hệ gen người

            Những cơ chế bảo vệ đó sớm được lựa chọn cho một mục đích khác: kiểm soát hoạt động gen của chính tế bào. “Những cơ chế để kiểm soát transposon trở thành các cơ chế để kiểm soát các gen”, theo nhà nghiên cứu tiến hóa hệ gen Ryan Grogory tại Đại học Guelph, Canada. Lược sử tiến hóa hệ gen người

Hình thành cơ thể Lược sử tiến hóa hệ gen người

Giai đoạn giờ đã được định ra cho bước tiến lớn tiếp theo của tiến hóa, khoảng 800 triệu năm trước, khi tế bào bắt đầu phối hợp với nhau chặt chẽ hơn bao giờ hết. Mặc dù một số ít vi khuẩn là đa bào, những hạn chế về tính phức tạp của chúng chưa bao giờ cho phép chúng vượt xa theo con đường này. Với sinh vật nhân chuẩn thì ngược lại, đã phát triển dưới hình thức đa bào qua hàng chục sự kiện, làm phát sinh các sinh vật cực kỳ phức tạp như nấm, rong biển, thực vật ở cạn, và dĩ nhiên là cả động vật. Lược sử tiến hóa hệ gen người

Một lý do là tập hợp các gen của chúng, cái mà có thể được lựa chọn cho các mục đích mới như là gắn kết các tế bào lại với nhau và giao tiếp với các tế bào khác. Thậm chí quan trọng hơn, bản chất phân mảnh của gen đã cho phép tiến hóa còn diễn ra nhanh hơn. Ví dụ, các protein gắn các tế bào lại, bao gồm một phần rìa của màng tế bào và một phần nhô ra ngoài. Với các gen phân mảnh, tất cả các loại nhô ra khác nhau có thể được gắn chặt vào phần màng tế bào, giống như các đầu phụ kiện khác nhau trên máy hút bụi. Nhiều gen quan trọng đối với sự đa bào hóa đã tiến triển thông qua sự xáo trộn exon.

Lược sử tiến hóa hệ gen người, lược sử, tiến hóa, hệ gen, genome, LUCA, Lược sử tiến hóa hệ gen người

Ngoài ra, các cơ chế tinh vi hơn của nhân thực để kiểm soát hoạt động gen được dùng để cho phép các tế bào chuyên hóa. Bằng cách bật tắt các nhóm các gen, các nhóm tế bào khác nhau có thể khác biệt về chức năng. Hệ quả là, các sinh vật có thể bắt đầu phát triển các loại mô khác nhau, cho phép các động vật ban đầu tiến hóa các cấu trúc dạng bọt biển cho tới các động vật với cơ thể phức tạp hóa dần dần.

Bước nhảy vọt tiếp theo là hệ quả của một cặp sự cố di truyền. Khi nhiều thứ diễn ra nhầm lẫn trong quá trình sinh sản, toàn bộ genome thi thoảng có thể được nhân đôi –  và điều này không chỉ diễn ra một mà tới hai lần trong tổ tiên của toàn bộ động vật có xương sống. Lược sử tiến hóa hệ gen người

Các genome được gấp đôi tạo ra rất nhiều bản sao của gen. Nhiều gen mất đi nhưng một số khác có được vai trò mới. Đặc biệt, sự lặp này đã tạo ra 4 cụm gen chuyên biệt để xây dựng lên sơ đồ cơ thể trong quá trình phát triển – các gen Hox – và các cụm này được cho là đã thực hiện vai trò quan trọng trong sự tiến hóa của bộ xương trong.

Sự gấp đôi toàn bộ hệ gen là hiếm hoi, và hầu hết các gen mới phát sinh từ các lần gấp đôi nhỏ hơn, hoặc từ sự xáo trộn exon, hoặc cả hai. Tiến hóa là “không biết xấu hổ” – nó sẽ tận dụng bất cứ DNA nào mà thực hiện việc gì đó hữu ích bất kể chúng đến từ đâu ! Một số gen mấu chốt đã tiến hóa từ các mảnh DNA “rác”, trong khi các gen khác có được từ một nơi nào đó. Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người

Ví dụ, khoảng 500 triệu năm trước, genome của tổ tiên chúng ta đã vị xâm chiếm bởi một thể ký sinh di truyền gọi là hAT transposon, tự nó sao chép sử dụng cơ chế “cắt và dán”. Sự cắt được thực hiện bởi hai enzyme bám vào trình tự DNA đặc hiệu. Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người

Ở một số điểm ở động vật có xương sống sớm, các trình tự được bám bởi các enzyme cắt DNA ấy nằm ngay cạnh hoặc trong một gen liên quan đến sự tiếp nhận sự xâm nhập của virus và vi khuẩn. Kết quả là trong đời sống của một cá thể, khi tế bào phân chia, genzyme hAT cắt đi các phần của gen. Một cách quan trọng là các phần khác nhau bị cắt đi trong các dòng tế bào khác nhau, hình thành nhiều phiên bản protein đột biến. Trong một số trường hợp, nó lại trở thành yếu tố cứu sinh, bởi vì các protein đột biến đã tốt hơn trong việc ngăn cản yếu tố gây bệnh xâm nhập. Không lâu sau một cơ chế đã tiến hóa để nhận ra các tế bào có thể tạo ra các phiên bản hiệu quả nhất và thúc đẩy chúng nhân lên – hệ miễn dịch đáp ứng. Hệ thống miễn dịch của người giờ đây là rất phức tạp, nhưng 2 enzyme cắt và tái sắp xếp gen – quá trình quan trọng cho phép miễn dịch nhắm đến đối tượng xâm nhiễm – chính là hậu duệ trực tiếp của các enzyme hAT. Vì thế chúng ta có một thể ký sinh cổ xưa để cảm kích vì một vũ khí hiệu quả chống lại bệnh tật.

Lược sử tiến hóa hệ gen người, lược sử, tiến hóa, hệ gen, genome, LUCA,

Genome người Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người

            Dựa vào những tuyến phòng thủ được nâng cấp, và với một bộ công cụ di truyền có thể được uốn nắn để tạo ra một sự đang dạng lớn các cấu trúc cơ thể, động vật có xương sống đã thực sự thành công. Chúng xâm chiếm các đại dương, nảy nở trên mặt đất, leo trèo trên cây và sau đó quay trở lại mặt đất rồi bắt đầu bước đi trên hai chân.

            Điều gì khiến chúng ta khác biệt với những loài khỉ hình người (tinh tinh – apes) khác? Có một khác biệt lớn giữa ta và chúng: chúng ta có 23 nghiễm sắc thể chứ không phải 24 như tinh tinh cổ. Nhưng các nhiễm sắc thể là các túi đựng gen cần thiết: nó tạo ra một chút khác biệt nếu chúng tách ra hoặc nhập vào nhau miễn là chúng ta vẫn có các gene chúng ta cần. Thay vào đó, có vẻ có một chuỗi dài các thay đổi nhỏ hơn một cách từ từ thay đổi não bộ và cơ thể chúng ta. Chúng ta đã xác định được một vài đột biến mấu chốt (New Scientist , 9 June, p 34), nhưng có lẽ có nhiều ngàn đột biến liên quan.

            Nhìn lại bức tranh lớn, rõ ràng sự tăng tính phức tạp của tế bào và cơ thể bắt đầu với sự tăng tính phức tạp của genome. Mặc dù vậy, điều nổi bật là nhiều sự gia tăng ban đầu về tính phức tạp là vì thiếu chọn lọc tiến hóa, chứ không phải bởi chọn lọc tiến hóa. “Hầu hết những cái đang diễn ra ở cấp độ hệ gen dường như là trung tính”, theo Gregore. Nói các khác, các đột biến phát sinh dường như ít tác động, như là một sự gấp đôi gen. Trong một quần thể lớn, các đột biến này sớm biến mất. Nhưng trong quần thể nhỏ, chúng có thể thay đổi, thông qua biến đổi di truyền (genetic drift). Đây là một hệ quả không thể tránh khỏi của di truyền quần thể,” Koonin cho biết. Chỉ sau khi tính phức tạp này được chọn, chẳng hạn như khi một gen trùng lặp có được một vai trò mới.

            Nhiều sự kiện tầm cỡ trong lịch sử, như là gấp đôi genome đã tạo ra các gen Hox, có lẽ là hệ quả của sự chọn lọc không khắt khe ở một quần thể nhỏ. Thật vậy, một quần thể thắt cổ chai ngay khi bắt đầu tiến hóa loài người có lẽ giải thích cho sự phát tán một số đột biến làm cho chúng ta khác với các loài khỉ không đuôi khác, như là mất sức mạnh cơ bắp.

            Điều nổi bật khác là virus và các thể ký sinh cũng thể hiện vai trò to lớn. Nhiều trong số các đặc điểm của genome chúng ta, từ giới tính cho tới sự methyl hóa, đã tiến hóa trong sự đáp ứng lại cuộc tấn công của chúng. Hơn nữa, một số lượng không nhỏ các gen và exon của ta, như là các enzyme miễn dịch, có nguồn gốc trực tiếp từ các kẻ xâm lăng này. “Virus là các hạt cần thiết đối với đời sống tế bào ngay từ thời khắc ban đầu”, Koonin cho biết thêm. Cần thiết nhưng không dễ chịu gì. Sự tiến hóa của chúng ta đến từ một cái giá rất đắt. Người ta bảo rằng lịch sử được viết lên bởi chiến thắng – đúng, genome của chúng ra là một bản ghi chép cho những chiến tích, cho những trải nghiệm thành công hoặc tối thiểu là đã không giết chết tổ tiên của ta. Chúng ta là hậu duệ của một chuỗi dài những kẻ chiến thắng cuộc may rủi, một trò xổ số trong đó giải thưởng đã trao cho thế hệ con cháu được sinh ra, rồi tồn tại đủ lâu để tự sinh sản. Qua chặng đường dài đó, bao nhiêu thất bại không kể siết, với hàng ngàn tỉ động vật đã đang chết những cái chết thường là kinh khủng. Lược sử tiến hóa hệ gen người

            Genome của chúng ta chưa phải một sản phẩm hoàn tất, được trau dồi một cách hoàn hảo. Thực tế, nó vẫn được chắp vá qua quít từ những tàn dư của các biến cố di truyền và các thể ký sinh cổ xưa còn tồn tại. Nó là sản phẩm của một dạng thí nghiệm ngu ngốc, không được kiểm soát và có thể bị loại trừ mà không cần suy xét bởi bất cứ chuẩn mực nào. Và quá trình này tiếp diễn đến ngày nay – đi đến bất kỳ bệnh viện nào và bạn có thể thấy trẻ em đang chết vì các bệnh di truyền tồi tệ. Nhưng số cái chết có lẽ không nhiều bằng so với trong quá khứ. Nhờ vào các phương pháp như là sàng lọc phôi, chúng ta bắt đầu kiểm soát được quá trình tiến hóa genome chúng ta. Một kỷ nguyên mới đang bắt đầu. Lược sử tiến hóa hệ gen ngườiLược sử tiến hóa hệ gen người

From issue2882 of New Scientist magazine, page 30-35.

Đọc thêm: Sự xuất hiện của oxy và tiến hóa ty thể

Tổ tiên chung đầu tiên của sinh giới

iceberg (biên tập)

tapchisinhhoc.com

Lược sử tiến hóa hệ gen người
4.9 (97.5%) 8 votes

Leave a Reply